Chapter 5: Molecular Basis of Inheritance

Following is the grouping:

As per Chargaff’s rule, DNA molecules are required to have an equal ratio of purine (adenine and guanine) and pyridine (cytosine and thymine). This is to say that the number of adenine molecules is equivalent to the cytosine molecule.

Percentage of adenosine = percentage of thymine

Percentage of guanine = percentage of cytosine

Hence, according to the law, if the double-stranded DNA has 20% of cytosine, it should have 20% of guanine. Therefore, the percentage of G + percentage of C = 40%

The other 60% indicates both A + T percentage molecules. As adenine and thymine are always found in equal numbers, the adenine content is 30%.

With regard to base sequence, DNA strands are complementary to each other. Therefore, if the sequence of one strand of DNA is written as:

5′ -ATGCATGCATGCATGCATGCATGCATGC-3′

The sequence of the complementary strand in 3′ -> 5′ is as follows:

3′ – TACGTACGTACGTACGTACGTACGTACG – 5′

Subsequently, the sequence of the complementary strand in 5’→3′ direction is written as:

5′ – GCATGCATGCATGCATGCATGCATGCAT – 3′

In a transcription unit, if the coding strand is as follows:

5′ -ATGCATGCATGCATGCATGCATGCATGC-3′

Then the sequence that codes for nothing are the same as mRNA, except that in mRNA, uracil replaces thymine. Hence, the mRNA sequence is as written below:

5′ -AUGCAUGCAUGCAUGCAUGCAUGCAUGC-3′

Watson and Crick noted that the two DNA strands are anti-parallel, complementary to each other with regards to their base sequences which facilitates each strand to serve as a template to synthesise a new strand. This organisation of the DNA molecule furthered the hypothesis that the replication of DNA is semi-conservative. In other words, the double-stranded DNA molecule splits, and in turn, each of the separated strands serves as a template to synthesise a new complementary strand. Subsequently, each DNA molecule will have one parental strand and a newly synthesised daughter strand. As only one parental strand is conserved in each of the daughter molecules, the mode of replication is termed as semi-conservative.

The sequence of bases in the template strand because of complementary base pairing governs the sequence of bases in the daughter strand. Subsequently, this property of DNA led Watson and Crick to hypothesise the semi-conservative mode of replication.

The list includes two different types of nucleic acid polymerases:

• DNA-dependent DNA polymerases
• DNA-dependent RNA polymerases
• RNA-dependent DNA polymerases
• RNA-dependent RNA polymerases

To synthesise a new strand, the DNA-dependent DNA polymerases use a DNA template. But, DNA-dependent RNA polymerases utilise a DNA template strand to synthesise RNA.

To prove DNA is the genetic material, Hershey and Chase studied and worked on bacteriophage and E.Coli. To label the protein coat and DNA of the bacteriophage, they used different radioactive isotopes. In a medium containing radioactive phosphorous (32P), they cultivated some bacteriophages to detect DNA and a few more on a medium comprising radioactive sulphur (35S) to detect protein. The labelled radioactive phages were then made to infect the bacteria – E.coli. Once infected, the protein coat of the bacteriophage was segregated from the bacterial cell by mixing and then subject to the centrifugation process.

It was observed that, in the supernatant, as the protein coat was lighter, the infected bacteria got settled at the bottom of the centrifuge tube. In case I – the supernatant was observed to be radioactive, indicating that the protein did not enter the bacterial cell when infected. But in case II – the bacterial cells were radioactive as they possess radioactive DNA. Thus, it was proved that DNA is a genetic material as it was transferred from viruses to bacteria.

(a) Repetitive DNA and Satellite DNA

(b) mRNA and tRNA

(c) Template Strand and Coding Strand

Two essential roles of the ribosome during translation are as given below:

• Ribosomes are sites where the synthesis of proteins occurs from individual amino acids. It consists of two subunits – the larger subunit serves as an amino acid binding site, whereas the smaller subunit attaches to the mRNA forming a protein-synthesising complex
• Since the large subunit of the ribosome has two different sites to attach to tRNA, it facilitates amino acids to come closer for peptide bond formation. Also, the ribosome behaves as a catalyst for the formation of the peptide bond. Example – 23s r-RNA acts as a ribozyme in bacteria

A segment of DNA which comprises three adjacent structural genes – a promoter gene, an operator gene, and a regulator gene is known as a lac operon. It is functional in a coordinated manner in order to metabolise lactose into galactose and glucose. Lactose serves as an inducer in the lac operon, which binds to the repressor, inactivating it. Once the lactose is bound to the repressor, RNA polymerase binds to the area of the promoter. Therefore, the structural genes express their product, and corresponding enzymes are yielded. Lactose is metabolised due to the action of enzymes into galactose and glucose. Later on, the level of inducer decreases as enzymes completely metabolise them, which results in the synthesis of the repressor from the regulator gene. Thus, the repressor is bound to the operator gene, restricting RNA polymerase from transcribing the operon; subsequently, transcription is ceased. This kind of regulation is termed negative regulation.